Tumor-intrinsic FABP5 is a novel driver for colon cancer cell growth via the HIF-1 signaling pathway

  • Jieun Seo
    Affiliations
    Department of Biomedical Sciences, Seoul National University College of Medicine, Seoul 03080, South Korea

    Department of Physiology, Seoul National University College of Medicine, Seoul 03080, South Korea

    Faculty of Engineering, Yokohama National University, Yokohama 240-8501, Japan
    Search for articles by this author
  • JeongEun Yun
    Affiliations
    Department of Biomedical Sciences, Seoul National University College of Medicine, Seoul 03080, South Korea

    Department of Physiology, Seoul National University College of Medicine, Seoul 03080, South Korea
    Search for articles by this author
  • Junji Fukuda
    Affiliations
    Faculty of Engineering, Yokohama National University, Yokohama 240-8501, Japan
    Search for articles by this author
  • Yang-Sook Chun
    Correspondence
    Corresponding author at: Department of Biomedical Sciences and Physiology, Seoul National University College of Medicine, Daehakro 103, Jongro-gu, Seoul 03080, South Korea.
    Affiliations
    Department of Biomedical Sciences, Seoul National University College of Medicine, Seoul 03080, South Korea

    Department of Physiology, Seoul National University College of Medicine, Seoul 03080, South Korea

    Ischemic/Hypoxic Disease Institute, Seoul National University College of Medicine, Seoul 03080, South Korea
    Search for articles by this author
Open AccessPublished:November 05, 2021DOI:https://doi.org/10.1016/j.cancergen.2021.11.001

      Highlights

      • A modulator for cancer cell proliferation related with lipid metabolism is needed to be figure out.
      • It is revealed by informatics that FABP5 levels are upregulated in colon cancer tissues.
      • The enhanced FABP5 levels are correlated with the enriched-HIF-1 target gene levels.
      • The 3D culture mimicking in vivo revealed that tumor growth is reinforced by FABP5.
      • FABP5 regulates HIF-1 signaling pathway positively.
      • The FABP5/HIF-1α axis is a promising target for reversing colon cancer progression.

      Abstract

      Dysfunctional lipid metabolism is a known cause of cancer development and progression, yet little is known about the underlying molecular mechanisms that contribute to cancer progression. In this study, we demonstrate that fatty acid binding protein 5 (FABP5) is elevated in colon cancer tissue and this increased expression is linked to upregulation of the hypoxia-inducible factor-1 (HIF-1) signaling pathway. Under physiologically in vivo mimicked conditions via a polydimethylsiloxane (PDMS)-based three-dimensional (3D) culture chip, FABP5-knockdown colon cancer cells exhibited attenuated cell growth throughout the culture period. FABP5 was found to regulate HIF-1α protein levels and gene expression levels within the HIF-1α signaling pathway under hypoxic conditions. Our results provide evidence that supports the use of FABP5 as a prognostic factor in colon cancer. The FABP5/HIF-1α axis is a promising target for ameliorating fatty acid-triggered cancer progression.

      Keywords

      Introduction

      A fatty acid (FA) is a carboxylic acid with a long aliphatic chain containing an even number of carbons ending with carboxylic and alkyl group at one end. In FA metabolism, complex lipid species such as phospholipids, sphingolipids, and glycerolipids, which are essential components of cell membranes, signaling pathways and energy sources within the cell, are synthesized [
      • de Carvalho C.C.C.R.
      • Caramujo M.J.
      The Various Roles of Fatty Acids.
      ]. Although healthy cells maintain lipid homeostasis through dietary intake and in vivo synthesis, cancer cells have dynamically altered FA metabolism that impacts de novo lipogenesis, FA uptake, lipid storage, and B-oxidation [
      • Ibarguren M.
      • Lopez D.J.
      • Escriba P.V.
      The effect of natural and synthetic fatty acids on membrane structure, microdomain organization, cellular functions and human health.
      ,
      • Koundouros N.
      • Poulogiannis G.
      Reprogramming of fatty acid metabolism in cancer.
      ,
      • Harris A.L.
      Hypoxia - A key regulatory factor in tumour growth.
      ]. The rewiring lipid metabolism in cancer cells has become a promising strategy to survive under nutrient- and oxygen-deficient circumstances, but the underlying mechanisms for this process are still unclear.
      Hypoxia-inducible factor −1 alpha (HIF-1α) is a transcription factor that regulates the cellular response to oxygen levels. HIF-1α has been shown to regulate cancer cell growth and survival through transactivating survival- and metabolism-related genes [
      • Benita Y.
      • Kikuchi H.
      • Smith A.D.
      • Zhang M.Q.
      • Chung D.C.
      • Xavier R.J.
      An integrative genomics approach identifies Hypoxia Inducible Factor-1 (HIF-1)-target genes that form the core response to hypoxia.
      ]. In response to low oxygen levels, HIF-1α mediates an increase in FA uptake and lipid storage while downregulating B-oxidation and lipolysis, enhancing cancer cell proliferation and migration [
      • Huang T.Li
      • Li X.
      • Zhang L.
      • Sun L.
      • He X.
      • Zhong X.
      • Jia D.
      • Song L.
      • Semenza G.L.
      • Gao P.
      • Zhang H.
      HIF-1-mediated suppression of acyl-CoA dehydrogenases and fatty acid oxidation is critical for cancer progression.
      ,
      • Mylonis I.
      • Sembongi H.
      • Befani C.
      • Liakos P.
      • Siniossoglou S.
      • Simos G.
      Hypoxia causes triglyceride accumulation by HIF-1-mediated stimulation of lipin 1 expression.
      ,
      • Bensaad K.
      • Favaro E.
      • Lewis C.A.
      • Peck B.
      • Lord S.
      • Collins J.M.
      • Pinnick K.E.
      • Wigfield S.
      • Buffa F.M.
      • Li J.L.
      • Zhang Q.
      • Wakelam M.J.O.
      • Karpe F.
      • Schulze A.
      • Harris A.L.
      Fatty acid uptake and lipid storage induced by HIF-1alpha contribute to cell growth and survival after hypoxia-reoxygenation.
      ,
      • Krishnan J.
      • Suter M.
      • Windak R.
      • Krebs T.
      • Felley A.
      • Montessuit C.
      • Tokarska-Schlattner M.
      • Aasum E.
      • Bogdanova A.
      • Perriard E.
      • Perriard J.C.
      • Larsen T.
      • Pedrazzini T.
      • Krek W.
      Activation of a HIF1alpha-PPARgamma axis underlies the integration of glycolytic and lipid anabolic pathways in pathologic cardiac hypertrophy.
      ,
      • Triantafyllou E.A.
      • Georgatsou E.
      • Mylonis I.
      • Simos G.
      • Paraskeva E.
      Expression of AGPAT2, an enzyme involved in the glycerophospholipid/triacylglycerol biosynthesis pathway, is directly regulated by HIF-1 and promotes survival and etoposide resistance of cancer cells under hypoxia.
      ,
      • Liu Y.
      • Ma Z.
      • Zhao C.
      • Wang Y.
      • Wu G.
      • Xiao J.
      • McClain C.J.
      • Li X.
      • Feng W.
      HIF-1alpha and HIF-2alpha are critically involved in hypoxia-induced lipid accumulation in hepatocytes through reducing PGC-1alpha-mediated fatty acid beta-oxidation.
      ,
      • Du W.
      • Zhang L.
      • Brett-Morris A.
      • Aguila B.
      • Kerner J.
      • Hoppel C.L.
      • Puchowicz M.
      • Serra D.
      • Herrero L.
      • Rini B.I.
      • Campbell S.
      • Welford S.M.
      HIF drives lipid deposition and cancer in ccRCC via repression of fatty acid metabolism.
      ,
      • Han J.S.
      • Lee J.H.
      • Kong J.
      • Ji Y.
      • Kim J.
      • Choe S.S.
      • Kim J.B.
      Hypoxia Restrains Lipid Utilization via Protein Kinase A and Adipose Triglyceride Lipase Downregulation through Hypoxia-Inducible Factor.
      ,
      • Jain I.H.
      • Calvo S.E.
      • Markhard A.L.
      • Skinner O.S.
      • To T.L.
      • Ast T.
      • et al.
      Genetic Screen for Cell Fitness in High or Low Oxygen Highlights Mitochondrial and Lipid Metabolism.
      ]. Based on the previous reports, HIF-1α is regarded as a key regulator for lipid metabolic shift, while modulators for HIF-1α in response to FA are under studied. We have previously reported that oleic acid (OA) stimulates HIF-1α protein expression and activity to accelerate lipid accumulation in hepatocellular carcinoma. The process is regulated by fatty acid binding protein 5 (FABP5), which has been reported as an OA transporter [
      • Seo J.
      • Jeong D.-.W.
      • Park J.-.W.
      • Lee K.-.W.
      • Fukuda J.
      • Chun Y.-.S.
      Fatty-acid-induced FABP5/HIF-1 reprograms lipid metabolism and enhances the proliferation of liver cancer cells.
      ,
      • Siegenthaler G.
      • Hotz R.
      • Chatellard-Gruaz D.
      • Jaconi S.
      • Saurat J.H.
      Characterization and expression of a novel human fatty acid-binding protein: the epidermal type (E-FABP).
      ,
      • Smathers R.L.
      • Petersen D.R.
      The human fatty acid-binding protein family: evolutionary divergences and functions.
      ]. Although studies have shown that FABP5 enhances cancer cell proliferation and invasion through PPARβ/δ, p53, and nuclear factor-kappa B (NF-kB) signaling, they lack the association of FABP5 with its original role in FA [
      • Kawaguchi K.
      • Senga S.
      • Kubota C.
      • Kawamura Y.
      • Ke Y.
      • Fujii H.
      High expression of Fatty Acid-Binding Protein 5 promotes cell growth and metastatic potential of colorectal cancer cells.
      ,
      • Liu R.Z.
      • Graham K.
      • Glubrecht D.D.
      • Germain D.R.
      • Mackey J.R.
      • Godbout R.
      Association of FABP5 expression with poor survival in triple-negative breast cancer: implication for retinoic acid therapy.
      ,
      • Wang W.
      • Chu H.J.
      • Liang Y.C.
      • Huang J.M.
      • Shang C.L.
      • Tan H.
      • Liu D.
      • Zhao Y.H.
      • Liu T.Y.
      • Yao S.Z.
      FABP5 correlates with poor prognosis and promotes tumor cell growth and metastasis in cervical cancer.
      ,
      • Fang L.Y.
      • Wong T.Y.
      • Chiang W.F.
      • Chen Y.L.
      Fatty-acid-binding protein 5 promotes cell proliferation and invasion in oral squamous cell carcinoma.
      ,
      • Jeong C.Y.
      • Hah Y.S.
      • Cho B.I.
      • Lee S.M.
      • Joo Y.T.
      • Jung E.J.
      • Jeong S.H.
      • Lee Y.J.
      • Choi S.K.
      • Ha W.S.
      • Park S.T.
      • Hong S.C.
      Fatty acid-binding protein 5 promotes cell proliferation and invasion in human intrahepatic cholangiocarcinoma.
      ,
      • Morgan E.
      • Kannan-Thulasiraman P.
      • Noy N.
      Involvement of Fatty Acid Binding Protein 5 and PPARbeta/delta in Prostate Cancer Cell Growth.
      ]. Additional study into the FABP5/HIF-1α axis could provide mechanistic evidence for the role that FA-induced FABP5 plays in triggering cancer cell proliferation.
      Colon cancer is an obesity-related cancer with high levels of FABP5 expression [
      • Kawaguchi K.
      • Senga S.
      • Kubota C.
      • Kawamura Y.
      • Ke Y.
      • Fujii H.
      High expression of Fatty Acid-Binding Protein 5 promotes cell growth and metastatic potential of colorectal cancer cells.
      ,
      • Calle E.E.
      • Rodriguez C.
      • Walker-Thurmond K.
      • Thun M.J.
      Overweight, obesity, and mortality from cancer in a prospectively studied cohort of U.S. adults.
      ,
      • Larsson S.C.
      • Wolk A.
      Obesity and colon and rectal cancer risk: a meta-analysis of prospective studies.
      ]. Alterations in lipid metabolic pathways in colon cancer have been shown to have tumor-progressive effects, highlighting the importance of understanding FA metabolic shifts [
      • Vecchia S.La L.
      • Sebastián C.
      Metabolic pathways regulating colorectal cancer initiation and progression.
      ]. Recently, an interesting aspect of cancer was reported that the rate of metastasis in colon cancer is increased with lipid treatment through a HIF-1α dependent pathway [
      • Seo J.
      • Kim K.S.
      • Park J.-.W.
      • Cho J.-.Y.
      • Chang H.
      • Fukuda J.
      • et al.
      Metastasis-on-a-chip reveals adipocyte-derived lipids trigger cancer cell migration via HIF-1α activation in cancer cells.
      ]. Considering the previously reported researches on FABP5 and HIF-1α, we hypothesize that the FABP5/HIF-1α axis is a relevant prognostic factor for colon cancer. Herein, we report that FABP5 mRNA levels are upregulated in colon cancer tissue, and this FABP5 expression is positively correlated with enriched-HIF-1α target genes. In colon cancer cells, FABP5 knockdown significantly suppressed HIF-1α protein levels and downstream target genes under hypoxic conditions. Additionally, FABP5 induces three-dimensional (3D) cell proliferation in colon cancer cells through modulating HIF-1 target gene levels. This research suggests that the association between FABP5 and HIF-1α may be involved in the mechanism underlying lipid-related cancer progression.

      Materials & methods

       Cell culture

      Human colon cancer cell lines were obtained from the Korean Cell Line Bank (Seoul, Republic of Korea). Cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (Welgene, Republic of Korea) and 1% penicillin/streptomycin (Thermo Fisher Scientific, USA). Gas tension was maintained at 21% O2/5% CO2 for normoxic conditions and 1% O2/5% CO2 for hypoxic conditions (VS-9000GC; Vision Scientific, Republic of Korea).

       Short interfering RNAs (siRNAs) and transfection

      The siRNA sequences targeting FABP5 (NM_001444) are GGAUCAUCCCUUUGGUUAAUAAATA (si-FABP5 #1) and CAUUGUGAUGGUAAAAACCUCACC (si-FABP5 #2). Cells were transfected with the relevant siRNAs using Lipofectamine RNA iMAX (Invitrogen, USA).

       Three-dimensional culture

      Methods for 3D cell culture were designed by Prof. Fukuda and employed as previously described [
      • Seo J.
      • Kim K.S.
      • Park J.-.W.
      • Cho J.-.Y.
      • Chang H.
      • Fukuda J.
      • et al.
      Metastasis-on-a-chip reveals adipocyte-derived lipids trigger cancer cell migration via HIF-1α activation in cancer cells.
      ,
      • Myasnikova D.
      • Osaki T.
      • Onishi K.
      • Kageyama T.
      • Zhang Molino B.
      • Fukuda J.
      Synergic effects of oxygen supply and antioxidants on pancreatic beta-cell spheroids.
      ,
      • Kageyama T.
      • Yoshimura C.
      • Myasnikova D.
      • Kataoka K.
      • Nittami T.
      • Maruo S.
      • et al.
      Spontaneous hair follicle germ (HFG) formation in vitro, enabling the large-scale production of HFGs for regenerative medicine.
      ]. Briefly, 5 × 105 cancer cells were dispersed in 4 mL of culture medium and seeded onto a polydimethylsiloxane (PDMS) plate coated with 4% pluronic (Sigma, USA). Cell aggregates were incubated on the PDMS plate for 7 days, and the average diameter was calculated using ImageJ.

       Western blot analysis

      Cell lysates were separated using dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto Immobilon-P membranes (Millipore, USA). The membranes were blocked with 5% skim milk dissolved in Tris-buffered saline containing 0.1% Tween 20 (TBST) for 1 h, and then incubated with the primary antibody overnight at 4 °C. After a brief wash with TBST, the membranes were incubated with a horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature and visualized using an ECL Plus kit (Thermo Fisher Scientific). Anti-FABP5 was purchased from R&D Systems (USA) and anti-B-tubulin from Santa Cruz Biotechnology (USA). Anti-HIF-1α antibodies were generated against human HIF-1α in rabbits, as described previously [
      • Li S.H.
      • Shin D.H.
      • Chun Y.S.
      • Lee M.K.
      • Kim M.S.
      • Park J.W.
      A novel mode of action of YC-1 in HIF inhibition: stimulation of FIH-dependent p300 dissociation from HIF-1{alpha}.
      ].

       RNA isolation and real-time quantitative pcr (RT-qPCR)

      Total RNA from cell aggregates or cell cultures were extracted using TRIzol reagent (Invitrogen), and cDNA was synthesized using an EasyScript cDNA Synthesis Kit (Applied Biological Materials Inc., Canada). RT-qPCR was conducted with 48-well plates and Evagreen qPCR Master Mix (Applied Biological Materials Inc.) using a StepOne™ Real-time PCR system (Applied Biosystems, USA). The sequences for the qPCR primers are listed in Table 1. The mRNA expression levels were normalized against the 18S rRNA expression level.
      Table 1The primer sequences for RT-qPCR.
      Forward 5′−3′Reverse 3′−5′
      18STTCGTATTGAGCCGCTAGACTTTCGCTCTGGTCCGTCTT
      FABP5AGCAGCTGGAAGGAAGATGGCTGATGCTGAACCAATGCAC
      VEGFCGTGTACGTTGGTGCCCGCTCCGCTCTGAGCAAGGCCCAC
      LOXAGGGGTAGGGAGTTGGAGCGGCCTAAACGTCAGCAGGCGACGG
      CA9TCCTGGGCTTCCAGCTCCCGGCCCAGGAGGCAGGGTCAGT
      BNIP3LTGCGAGGAAAATGAGCAGTCTGCCATTGCTGCTGTTCATG
      PDK1CGTCCCCGCTCTCCATGAAGCTGACAGGCAACTCTTGCCGCAG
      PGK1GGCACTGCTCACAGAGCCCATCAAAAACCCCACCAGCCTTCTGTG
      ALDOAGGTACGCAGGGGTGCCTCAAAATCTTTGGCCAGGGACCTCCT

       Informatics analysis

      Gene expression patterns in colon cancer patients were analyzed using the publicly available NCBI Gene Expression Omnibus (GEO) database (www.ncbi.nlm.nih.gov/geo, GSE8671). FABP5 mRNA levels (202,345_s_at; corresponding to FABP5) were compared between groups. For gene set enrichment analysis (GSEA; available from http://www.broadinstitute.org/gsea), the dataset was divided into high- and low-FABP5 groups based on the mean value of FABP5 (202,345_s_at). A false discovery rate adjusted q-value < 0.25 was considered to indicated statistical significance.

       Statistical analysis

      All data were analyzed using GraphPad Prism 8 software (GraphPad Inc., USA) and presented as the mean and standard deviation or standard error of the mean. To compare differences between groups, two-tailed and unpaired Student's t tests were performed. P-values less than 0.05 or 0.0001 (*: P < 0.05; **: P < 0.0001) were considered to indicate statistical significance.

      Results

      Identification of Fatty acid binding protein 5 (FABP5) and hypoxia-inducible factor-1 alpha (HIF-1α) levels in colon cancer tissues
      FABP5 levels were analyzed using the NCBI GEO database (GSE8671) to investigate differential expression patterns between normal and colon tumor tissues. FABP5 mRNA expression was upregulated in colon cancer specimens (average: 8953.7; n = 32) compared to normal colon specimens from the same patients (average: 7196.2; n = 32) (Fig. 1A). We determined the correlation between FABP5 and HIF-1α-target gene expression using GSEA in the high- and low-FABP5 groups (Fig. 1B) and verified that the HIF-1α target genes were significantly enriched in the high-FABP5 group (Fig. 1C). Among HIF-1α target genes, core enrichment genes were indicated based on the rank metric score > 0.3 (Fig. 1D). Taken together, these data indicate that FABP5 and HIF-1α are elevated in colon cancer, and this relationship may be involved in colon cancer progression.
      Fig 1
      Fig. 1Fatty acid binding protein 5 (FABP5) is highly upregulated in human colon cancer tissues and is positively correlated with hypoxia-inducible factor-1 alpha (HIF-1α) levels. (A): FABP5 mRNA levels in colon cancer (n = 32) and normal colon (n = 32) tissues from the same patients, which were obtained from the NCBI Gene Expression Omnibus database (GSE8671). (B): High- and low- FABP5 groups (n = 26 and n = 38, respectively) were categorized based on the mean FABP5 value. (C): Gene set enrichment analysis (GSEA) plot for the ELVIDGE_HIF1A_TARGETS_UP geneset for the high- and low-FABP5 groups. (D): Core enrichment genes based on the rank metric score > 0.3.

       FABP5 knockdown decreases HIF-1α protein levels and downstream target gene mRNA levels in colon cancer cells

      Given the potential role of FABP5 in colon cancer progression, we checked the expression level of FABP5 in various colon cancer cell lines including HCT116, WiDr, DLD1, Caco-2, HT29, Colo320, and SW480. FABP5 expression was detected in all cell lines, except for Caco-2 and HT29 (Fig. 2A). First, we selected HCT116 and WiDr that showed higher FABP5 protein levels to conduct FABP5 knockdown (KD) experiments. We found that FABP5 protein levels did not change significantly during hypoxia in both cell lines. However, hypoxia-induced HIF-1α protein levels were attenuated significantly in FABP5-KD cells (Fig. 3A and supplementary Fig. 1). The mRNA levels of the HIF-1 target genes (VEGF, CA9, and LOX) confirmed that the hypoxia-induced HIF-1 activity was repressed in FABP5-KD cells (Fig. 3B). Next, the FABP5/HIF-1α axis was further confirmed even using the cell lines showed low FABP5 expression levels (HT29 and Caco-2). The silencing of FABP5 decreased both hypoxia-induced HIF-1α protein level and its target gene mRNA levels in HT29 cell line. While in Caco-2 that showed the lowest FABP5 expression levels among the colon cancer cell lines, the effect of FABP5-KD was not detected by western blotting with anti-FABP5. Nevertheless, hypoxia-induced HIF-1α protein levels showed slightly decrease in FABP5-silenced Caco-2 cells. Thus, we further checked RT-qPCR and found that hypoxia-induced HIF-1α target gene mRNA levels were attenuated by FABP5 silencing (Supplementary Fig. 2A and 2B). Collectively, these data suggest that FABP5 positively modulates HIF-1α levels and its transcriptional activity under hypoxic conditions in colon cancer cell lines.
      Fig 2
      Fig. 2FABP5 protein levels in various colon cancer cell lines. (A): FABP5 protein levels in colon cancer cell lines (HCT116, WiDr, DLD1, Caco-2, HT29, Colo320, and SW480) as analyzed via western blotting.
      Fig 3
      Fig. 3FABP5 knockdown decreases HIF-1α protein levels and downstream target gene mRNA levels. (A and B): HCT116 and WiDr cells were treated with control siRNA (si-Con) or FABP5 siRNA (si-FABP5) and then incubated under normoxic or hypoxic conditions for (A) 8 h and (B) 16 h. Cells lysates were subjected to (A) western blotting with the indicated antibodies or (B) real-time quantitative PCR (RT-qPCR; mean + standard deviation; n = 3).

       The FABP5-HIF-1α axis promotes three-dimensional (3D) colon cancer cell proliferation

      We then verified the involvement of the FABP5/HIF-1α axis in colon cancer progression using oxygen-permeable 3D PDMS plates (Fig. 4A). We observed that both HCT116 cell aggregates expressing si-Con and si-FABP5 were formed immediately on day 1. Aggregates expressing si-Con exhibited continuous growth pattern along with an enlarged intracellular hypoxic region until day 7. However, si-FABP5-expressing aggregates were significantly smaller in diameter compared to si-Con expressing aggregates throughout the week-long culture period. Furthermore, the growth of HCT116 aggregates which were treated with si-FABP5, was attenuated in day 7 compared to the aggregates treated with si-Con (Fig. 4B and 4C). The mRNA levels of HIF-1 target genes (PDK1, VEGF, LOX, CA9, and BNIP3L) were downregulated in aggregates expressing si-FABP5 (Fig. 4D). Thus, our results indicate that FABP5 enhances cancer cell proliferation via modulating HIF-1 target genes.
      Fig 4
      Fig. 4The FABP5-HIF-1α axis promotes three-dimensional (3D) cell proliferation in colon cancer cells. (A): Schematic representation of the polydimethylsiloxane (PDMS) 3D culture chip with the details of the chip design. (B): Representative optical microscopy images of cultured HCT116 spheroids (scale bar = 200 μm). (C): Cells were transfected with si-Con or si-FABP5 and subjected to 3D culture. The average diameter was analyzed using ImageJ, and the data are presented as the mean + SD (n = 3). (D): Total RNA from spheroids was extracted and then subjected to RT-qPCR to determine the mRNA levels of HIF-1α target genes (mean + SD; n = 3).

      Discussion

      Fast-growing tumor tissues experience abnormally low oxygenation levels caused by defective vasculature. This leads to the stabilization and sequential activation of HIF-1, a transcription factor responsible for the oxygen-dependent regulation of angiogenesis, metastasis, metabolism, and cellular survival. Cancers expressing high levels of HIF-1 are more aggressive and exhibit increased resistance to chemotherapy, making the HIF-1 pathway an interesting target for future clinical therapies [
      • Harris A.L.
      Hypoxia - A key regulatory factor in tumour growth.
      ,
      • Muz B.
      • de la Puente P.
      • Azab F.
      • Azab A.K.
      The role of hypoxia in cancer progression, angiogenesis, metastasis, and resistance to therapy.
      ,
      • Iyer N.V.
      • Kotch L.E.
      • Agani F.
      • Leung S.W.
      • Laughner E.
      • Wenger R.H.
      • Gassmann M.
      • Gearhart J.D.
      • Lawler A.M.
      • Yu A.Y.
      • Semenza G.L.
      Cellular and developmental control of O2 homeostasis by hypoxia-inducible factor 1 alpha.
      ,
      • Wang G.L.
      • Semenza G.L.
      General involvement of hypoxia-inducible factor 1 in transcriptional response to hypoxia.
      ].
      HIF-1 plays a key role in multiple cancer-related metabolic pathways, including those associated with glucose, amino acid, and FA metabolism [
      • Harris A.L.
      Hypoxia - A key regulatory factor in tumour growth.
      ,
      • Semenza G.L.
      Targeting HIF-1 for cancer therapy.
      ,
      • Semenza G.L.
      HIF-1: upstream and downstream of cancer metabolism.
      ,
      • Denko N.C.
      Hypoxia, HIF1 and glucose metabolism in the solid tumour.
      ]. Recently, there has been growing interest in the relationship between cancer development and shifts in lipid metabolism. Several changes in cancer lipid metabolism are proceeded by the activation of HIF-1-dependent pathways, such as enhanced FA uptake through fatty acid binding proteins (FABPs) and PPARγ; increased lipid storage through LIPIN1, ADRP, and AGPAT2; suppression of FA oxidation through CPT1A, acyl-CoA dehydrogenases, and PGC-1α; decrease of lipolysis through ATGL. By doing so, elevated levels of intracellular lipids act as metabolic fuels for rapid cellular growth and migration in hepatocellular carcinoma, clear cell renal cell carcinoma, ovarian cancer, breast cancer, and glioblastoma [
      • Koundouros N.
      • Poulogiannis G.
      Reprogramming of fatty acid metabolism in cancer.
      ,
      • Huang T.Li
      • Li X.
      • Zhang L.
      • Sun L.
      • He X.
      • Zhong X.
      • Jia D.
      • Song L.
      • Semenza G.L.
      • Gao P.
      • Zhang H.
      HIF-1-mediated suppression of acyl-CoA dehydrogenases and fatty acid oxidation is critical for cancer progression.
      ,
      • Mylonis I.
      • Sembongi H.
      • Befani C.
      • Liakos P.
      • Siniossoglou S.
      • Simos G.
      Hypoxia causes triglyceride accumulation by HIF-1-mediated stimulation of lipin 1 expression.
      ,
      • Bensaad K.
      • Favaro E.
      • Lewis C.A.
      • Peck B.
      • Lord S.
      • Collins J.M.
      • Pinnick K.E.
      • Wigfield S.
      • Buffa F.M.
      • Li J.L.
      • Zhang Q.
      • Wakelam M.J.O.
      • Karpe F.
      • Schulze A.
      • Harris A.L.
      Fatty acid uptake and lipid storage induced by HIF-1alpha contribute to cell growth and survival after hypoxia-reoxygenation.
      ,
      • Krishnan J.
      • Suter M.
      • Windak R.
      • Krebs T.
      • Felley A.
      • Montessuit C.
      • Tokarska-Schlattner M.
      • Aasum E.
      • Bogdanova A.
      • Perriard E.
      • Perriard J.C.
      • Larsen T.
      • Pedrazzini T.
      • Krek W.
      Activation of a HIF1alpha-PPARgamma axis underlies the integration of glycolytic and lipid anabolic pathways in pathologic cardiac hypertrophy.
      ,
      • Triantafyllou E.A.
      • Georgatsou E.
      • Mylonis I.
      • Simos G.
      • Paraskeva E.
      Expression of AGPAT2, an enzyme involved in the glycerophospholipid/triacylglycerol biosynthesis pathway, is directly regulated by HIF-1 and promotes survival and etoposide resistance of cancer cells under hypoxia.
      ,
      • Liu Y.
      • Ma Z.
      • Zhao C.
      • Wang Y.
      • Wu G.
      • Xiao J.
      • McClain C.J.
      • Li X.
      • Feng W.
      HIF-1alpha and HIF-2alpha are critically involved in hypoxia-induced lipid accumulation in hepatocytes through reducing PGC-1alpha-mediated fatty acid beta-oxidation.
      ,
      • Du W.
      • Zhang L.
      • Brett-Morris A.
      • Aguila B.
      • Kerner J.
      • Hoppel C.L.
      • Puchowicz M.
      • Serra D.
      • Herrero L.
      • Rini B.I.
      • Campbell S.
      • Welford S.M.
      HIF drives lipid deposition and cancer in ccRCC via repression of fatty acid metabolism.
      ,
      • Han J.S.
      • Lee J.H.
      • Kong J.
      • Ji Y.
      • Kim J.
      • Choe S.S.
      • Kim J.B.
      Hypoxia Restrains Lipid Utilization via Protein Kinase A and Adipose Triglyceride Lipase Downregulation through Hypoxia-Inducible Factor.
      ,
      • Nieman K.M.
      • Kenny H.A.
      • Penicka C.V.
      • Ladanyi A.
      • Buell-Gutbrod R.
      • Zillhardt M.R.
      • Romero I.L.
      • Carey M.S.
      • Mills G.B.
      • Hotamisligil G.S.
      • Yamada S.D.
      • Peter M.E.
      • Gwin K.
      • Lengyel E.
      Adipocytes promote ovarian cancer metastasis and provide energy for rapid tumor growth.
      ,
      • Balaban S.
      • Shearer R.F.
      • Lee L.S.
      • van Geldermalsen M.
      • Schreuder M.
      • Shtein H.C.
      • Cairns R.
      • Thomas K.C.
      • Fazakerley D.J.
      • Grewal T.
      • Holst J.
      • Saunders D.N.
      • Hoy A.J.
      Adipocyte lipolysis links obesity to breast cancer growth: adipocyte-derived fatty acids drive breast cancer cell proliferation and migration.
      ]. These data indicate that a way to regulate HIF-1α expression is needed to control lipid metabolism for preventing abnormal growth of cancer cells. In this study, we suggest the possible role of HIF-1α in colon cancer with the implication on FA metabolism, as FABP5/HIF-1α axis. HIF-1α, which is modulated by FABP5, is found to regulate gene transcription levels that support colon cancer cell proliferation. Considering the previous study on HIF-1α dependently regulated metastasis under lipid-enriched condition, HIF-1α enhances tumor aggressiveness by triggering cancer cell proliferation via genetic modification and also metastasis by utilizing FA, through FABP5 in colon cancer [
      • Seo J.
      • Kim K.S.
      • Park J.-.W.
      • Cho J.-.Y.
      • Chang H.
      • Fukuda J.
      • et al.
      Metastasis-on-a-chip reveals adipocyte-derived lipids trigger cancer cell migration via HIF-1α activation in cancer cells.
      ].
      FABP5 is a FA transporter that is upregulated in several cancer types including colon cancer and has been associated with poor prognosis [
      • Kawaguchi K.
      • Senga S.
      • Kubota C.
      • Kawamura Y.
      • Ke Y.
      • Fujii H.
      High expression of Fatty Acid-Binding Protein 5 promotes cell growth and metastatic potential of colorectal cancer cells.
      ,
      • Liu R.Z.
      • Graham K.
      • Glubrecht D.D.
      • Germain D.R.
      • Mackey J.R.
      • Godbout R.
      Association of FABP5 expression with poor survival in triple-negative breast cancer: implication for retinoic acid therapy.
      ,
      • Wang W.
      • Chu H.J.
      • Liang Y.C.
      • Huang J.M.
      • Shang C.L.
      • Tan H.
      • Liu D.
      • Zhao Y.H.
      • Liu T.Y.
      • Yao S.Z.
      FABP5 correlates with poor prognosis and promotes tumor cell growth and metastasis in cervical cancer.
      ,
      • Fang L.Y.
      • Wong T.Y.
      • Chiang W.F.
      • Chen Y.L.
      Fatty-acid-binding protein 5 promotes cell proliferation and invasion in oral squamous cell carcinoma.
      ,
      • Jeong C.Y.
      • Hah Y.S.
      • Cho B.I.
      • Lee S.M.
      • Joo Y.T.
      • Jung E.J.
      • Jeong S.H.
      • Lee Y.J.
      • Choi S.K.
      • Ha W.S.
      • Park S.T.
      • Hong S.C.
      Fatty acid-binding protein 5 promotes cell proliferation and invasion in human intrahepatic cholangiocarcinoma.
      ,
      • Morgan E.
      • Kannan-Thulasiraman P.
      • Noy N.
      Involvement of Fatty Acid Binding Protein 5 and PPARbeta/delta in Prostate Cancer Cell Growth.
      ]. Recent studies have highlighted the importance of FABP5 in lipid metabolism, reporting that FABP4/5 inhibitors ameliorated dyslipidemia in mice with high-fat diet-induced obesity; FABP5 facilitated the upregulation of metabolism-related genes including ATP5B, LCHAD, ACO2, FH, and MFN2 in prostate cancer cells; and FABP5 increased the uptake of FAs into brain endothelial cells [
      • Lee G.S.
      • Pan Y.
      • Scanlon M.J.
      • Porter C.J.H.
      • Nicolazzo J.A.
      Fatty Acid-Binding Protein 5 Mediates the Uptake of Fatty Acids, but not Drugs, Into Human Brain Endothelial Cells.
      ,
      • Lan H.
      • Cheng C.C.
      • Kowalski T.J.
      • Pang L.
      • Shan L.X.
      • Chuang C.C.
      • et al.
      Small Molecule Dual FABP4/5 Inhibitors Ameliorate Dyslipidemia in Mice with Diet-Induced Obesity.
      ,
      • Senga S.
      • Kawaguchi K.
      • Kobayashi N.
      • Ando A.
      • Fujii H.
      A novel fatty acid-binding protein 5-estrogen-related receptor alpha signaling pathway promotes cell growth and energy metabolism in prostate cancer cells.
      ]. Although the impacts of FABP5 on metabolic responses are well known, the underlying mechanism of FABP5 as a lipid-related oncogene has yet to be fully investigated. In hepatocellular carcinoma, FABP5 levels are increased in response to oleic acid treatment, and this leads to activate HIF-1α [
      • Seo J.
      • Jeong D.-.W.
      • Park J.-.W.
      • Lee K.-.W.
      • Fukuda J.
      • Chun Y.-.S.
      Fatty-acid-induced FABP5/HIF-1 reprograms lipid metabolism and enhances the proliferation of liver cancer cells.
      ]. However, the above study was conducted in the context of FA treatment, further studies with FA untreated cancer cells are needed to identify intrinsic cancer physiology. In colon cancer, concentrations of palmitoleic acid, oleic acid, and arachidonic acid are increased, whereas those of linoleic acid and alpha linoleic acid are decreased compared to normal colon tissue, which implies altered FA composition is due to intrinsic cancer pathology, not exogenous factors such as dietary intake [
      • Mamalakis G.
      • Kafatos A.
      • Kalogeropoulos N.
      • Andrikopoulos N.
      • Daskalopulos G.
      • Kranidis A.
      Prostate cancer vs hyperplasia: relationships with prostatic and adipose tissue fatty acid composition.
      ,
      • Pratt V.C.
      • Watanabe S.
      • Bruera E.
      • Mackey J.
      • Clandinin M.T.
      • Baracos V.
      • Field C.J.
      Plasma and neutrophil fatty acid composition in advanced cancer patients and response to fish oil supplementation.
      ,
      • Pakiet A.
      • Kobiela J.
      • Stepnowski P.
      • Sledzinski T.
      • Mika A.
      Changes in lipids composition and metabolism in colorectal cancer: a review.
      ,
      • Qiu J.F.
      • Zhang K.L.
      • Zhang X.J.
      • Hu Y.J.
      • Li P.
      • Shang C.Z.
      • et al.
      Abnormalities in Plasma Phospholipid Fatty Acid Profiles of Patients with Hepatocellular Carcinoma.
      ,
      • Szachowicz-Petelska B.
      • Sulkowski S.
      • Figaszewski Z.A.
      Altered membrane free unsaturated fatty acid composition in human colorectal cancer tissue.
      ,
      • Zhang X.
      • Zhao X.W.
      • Liu D.B.
      • Han C.Z.
      • Du L.L.
      • Jing J.X.
      • Wang Y.
      Lipid levels in serum and cancerous tissues of colorectal cancer patients.
      ,
      • Fang Z.
      • He M.M.
      • Song M.Y.
      Serum lipid profiles and risk of colorectal cancer: a prospective cohort study in the UK Biobank.
      ]. Therefore, we looked into the genetic role of FABP5/HIF-1α in colon cancer progression. To identify the oncogenic effects of the axis, we employed a 3D culture chip model incorporating PDMS plates that allow high oxygen permeability into the spheroids. This 3D model allows for the growth of physiologically relevant tumor aggregates while avoiding central necrosis [
      • Myasnikova D.
      • Osaki T.
      • Onishi K.
      • Kageyama T.
      • Zhang Molino B.
      • Fukuda J.
      Synergic effects of oxygen supply and antioxidants on pancreatic beta-cell spheroids.
      ,
      • Kageyama T.
      • Yoshimura C.
      • Myasnikova D.
      • Kataoka K.
      • Nittami T.
      • Maruo S.
      • et al.
      Spontaneous hair follicle germ (HFG) formation in vitro, enabling the large-scale production of HFGs for regenerative medicine.
      ,
      • Anada T.
      • Fukuda J.
      • Sai Y.
      • Suzuki O.
      An oxygen-permeable spheroid culture system for the prevention of central hypoxia and necrosis of spheroids.
      ]. We found that FABP5-KD colon cancer cells exhibited the attenuated 3D cell growth with lower expression of HIF-1-target genes (PDK1, VEGF, LOX, CA9, and BNIP3L). Thus, FABP5 could be a promising prognostic factor that modulating tumor growth via HIF-1-dependent pathway in colon cancer.
      In conclusion, we demonstrate here that FABP5 triggers 3D cell growth in colon cancer cells via the HIF-1 signaling pathway. Our findings imply a regulatory role of the FABP5/HIF-1 axis in colon cancer cell growth and proliferation, with the axis potentially playing a role in lipid-associated cancer progression. From a therapeutic perspective, we suggest that targeting the FABP5/HIF-1α axis is a potential approach for reversing lipid-driven cancer development and progression.

      Conflicts of interest

      The authors declare no competing interests.

      Author contributions

      J.S.: Conceptualization, Data curation, Formal analysis, Methodology, Software, Validation, Visualization, Roles/Writing – original draft; J.Y.: Data curation, Formal analysis, Software; J.F.: Investigation, Resources; Y.S.C.: Conceptualization, Funding acquisition, Investigation, Project administration, Resources, Supervision, Validation, Writing – review & editing

      Acknowledgments

      This study was supported by National Research Foundation of Korea (No. 2018R1A5A2025964 and 2019R1A2C2083886 ) and Seoul National University Bundang Hospital ( 16–2020–007 ). J.S. received a scholarship from the BK21-plus program, Republic of Korea.

      Appendix. Supplementary materials

      References

        • de Carvalho C.C.C.R.
        • Caramujo M.J.
        The Various Roles of Fatty Acids.
        Molecules. 2018; 23: 10
        • Ibarguren M.
        • Lopez D.J.
        • Escriba P.V.
        The effect of natural and synthetic fatty acids on membrane structure, microdomain organization, cellular functions and human health.
        Bba-Biomembranes. 2014; 1838: 1518-1528
        • Koundouros N.
        • Poulogiannis G.
        Reprogramming of fatty acid metabolism in cancer.
        Brit J Cancer. 2019; 122: 4-22
        • Harris A.L.
        Hypoxia - A key regulatory factor in tumour growth.
        Nat Rev Cancer. 2002; 2: 38-47
        • Benita Y.
        • Kikuchi H.
        • Smith A.D.
        • Zhang M.Q.
        • Chung D.C.
        • Xavier R.J.
        An integrative genomics approach identifies Hypoxia Inducible Factor-1 (HIF-1)-target genes that form the core response to hypoxia.
        Nucleic Acids Res. 2009; 37: 4587-4602
        • Huang T.Li
        • Li X.
        • Zhang L.
        • Sun L.
        • He X.
        • Zhong X.
        • Jia D.
        • Song L.
        • Semenza G.L.
        • Gao P.
        • Zhang H.
        HIF-1-mediated suppression of acyl-CoA dehydrogenases and fatty acid oxidation is critical for cancer progression.
        Cell Rep. 2014; 8: 1930-1942
        • Mylonis I.
        • Sembongi H.
        • Befani C.
        • Liakos P.
        • Siniossoglou S.
        • Simos G.
        Hypoxia causes triglyceride accumulation by HIF-1-mediated stimulation of lipin 1 expression.
        J Cell Sci. 2012; 125 (Pt 14): 3485-3493
        • Bensaad K.
        • Favaro E.
        • Lewis C.A.
        • Peck B.
        • Lord S.
        • Collins J.M.
        • Pinnick K.E.
        • Wigfield S.
        • Buffa F.M.
        • Li J.L.
        • Zhang Q.
        • Wakelam M.J.O.
        • Karpe F.
        • Schulze A.
        • Harris A.L.
        Fatty acid uptake and lipid storage induced by HIF-1alpha contribute to cell growth and survival after hypoxia-reoxygenation.
        Cell Rep. 2014; 9: 349-365
        • Krishnan J.
        • Suter M.
        • Windak R.
        • Krebs T.
        • Felley A.
        • Montessuit C.
        • Tokarska-Schlattner M.
        • Aasum E.
        • Bogdanova A.
        • Perriard E.
        • Perriard J.C.
        • Larsen T.
        • Pedrazzini T.
        • Krek W.
        Activation of a HIF1alpha-PPARgamma axis underlies the integration of glycolytic and lipid anabolic pathways in pathologic cardiac hypertrophy.
        Cell Metab. 2009; 9: 512-524
        • Triantafyllou E.A.
        • Georgatsou E.
        • Mylonis I.
        • Simos G.
        • Paraskeva E.
        Expression of AGPAT2, an enzyme involved in the glycerophospholipid/triacylglycerol biosynthesis pathway, is directly regulated by HIF-1 and promotes survival and etoposide resistance of cancer cells under hypoxia.
        Biochim Biophys Acta Mol Cell Biol Lipids. 2018; 1863: 1142-1152
        • Liu Y.
        • Ma Z.
        • Zhao C.
        • Wang Y.
        • Wu G.
        • Xiao J.
        • McClain C.J.
        • Li X.
        • Feng W.
        HIF-1alpha and HIF-2alpha are critically involved in hypoxia-induced lipid accumulation in hepatocytes through reducing PGC-1alpha-mediated fatty acid beta-oxidation.
        Toxicol Lett. 2014; 226: 117-123
        • Du W.
        • Zhang L.
        • Brett-Morris A.
        • Aguila B.
        • Kerner J.
        • Hoppel C.L.
        • Puchowicz M.
        • Serra D.
        • Herrero L.
        • Rini B.I.
        • Campbell S.
        • Welford S.M.
        HIF drives lipid deposition and cancer in ccRCC via repression of fatty acid metabolism.
        Nat Commun. 2017; 8: 1769
        • Han J.S.
        • Lee J.H.
        • Kong J.
        • Ji Y.
        • Kim J.
        • Choe S.S.
        • Kim J.B.
        Hypoxia Restrains Lipid Utilization via Protein Kinase A and Adipose Triglyceride Lipase Downregulation through Hypoxia-Inducible Factor.
        Mol Cell Biol. 2019; 39
        • Jain I.H.
        • Calvo S.E.
        • Markhard A.L.
        • Skinner O.S.
        • To T.L.
        • Ast T.
        • et al.
        Genetic Screen for Cell Fitness in High or Low Oxygen Highlights Mitochondrial and Lipid Metabolism.
        Cell. 2020; 181 (e11): 716-727
        • Seo J.
        • Jeong D.-.W.
        • Park J.-.W.
        • Lee K.-.W.
        • Fukuda J.
        • Chun Y.-.S.
        Fatty-acid-induced FABP5/HIF-1 reprograms lipid metabolism and enhances the proliferation of liver cancer cells.
        Communications Biology. 2020; 3: 1
        • Siegenthaler G.
        • Hotz R.
        • Chatellard-Gruaz D.
        • Jaconi S.
        • Saurat J.H.
        Characterization and expression of a novel human fatty acid-binding protein: the epidermal type (E-FABP).
        Biochem Biophys Res Commun. 1993; 190: 482-487
        • Smathers R.L.
        • Petersen D.R.
        The human fatty acid-binding protein family: evolutionary divergences and functions.
        Hum Genomics. 2011; 5: 170-191
        • Kawaguchi K.
        • Senga S.
        • Kubota C.
        • Kawamura Y.
        • Ke Y.
        • Fujii H.
        High expression of Fatty Acid-Binding Protein 5 promotes cell growth and metastatic potential of colorectal cancer cells.
        FEBS Open Bio. 2016; 6: 190-199
        • Liu R.Z.
        • Graham K.
        • Glubrecht D.D.
        • Germain D.R.
        • Mackey J.R.
        • Godbout R.
        Association of FABP5 expression with poor survival in triple-negative breast cancer: implication for retinoic acid therapy.
        Am J Pathol. 2011; 178: 997-1008
        • Wang W.
        • Chu H.J.
        • Liang Y.C.
        • Huang J.M.
        • Shang C.L.
        • Tan H.
        • Liu D.
        • Zhao Y.H.
        • Liu T.Y.
        • Yao S.Z.
        FABP5 correlates with poor prognosis and promotes tumor cell growth and metastasis in cervical cancer.
        Tumour Biol. 2016; 37: 14873-14883
        • Fang L.Y.
        • Wong T.Y.
        • Chiang W.F.
        • Chen Y.L.
        Fatty-acid-binding protein 5 promotes cell proliferation and invasion in oral squamous cell carcinoma.
        J Oral Pathol Med. 2010; 39: 342-348
        • Jeong C.Y.
        • Hah Y.S.
        • Cho B.I.
        • Lee S.M.
        • Joo Y.T.
        • Jung E.J.
        • Jeong S.H.
        • Lee Y.J.
        • Choi S.K.
        • Ha W.S.
        • Park S.T.
        • Hong S.C.
        Fatty acid-binding protein 5 promotes cell proliferation and invasion in human intrahepatic cholangiocarcinoma.
        Oncol Rep. 2012; 28: 1283-1292
        • Morgan E.
        • Kannan-Thulasiraman P.
        • Noy N.
        Involvement of Fatty Acid Binding Protein 5 and PPARbeta/delta in Prostate Cancer Cell Growth.
        PPAR Res. 2010; 2010
        • Calle E.E.
        • Rodriguez C.
        • Walker-Thurmond K.
        • Thun M.J.
        Overweight, obesity, and mortality from cancer in a prospectively studied cohort of U.S. adults.
        N Engl J Med. 2003; 348: 1625-1638
        • Larsson S.C.
        • Wolk A.
        Obesity and colon and rectal cancer risk: a meta-analysis of prospective studies.
        Am J Clin Nutr. 2007; 86: 556-565
        • Vecchia S.La L.
        • Sebastián C.
        Metabolic pathways regulating colorectal cancer initiation and progression.
        Semin. Cell Dev. Biol. 2020; 98: 63-70
        • Seo J.
        • Kim K.S.
        • Park J.-.W.
        • Cho J.-.Y.
        • Chang H.
        • Fukuda J.
        • et al.
        Metastasis-on-a-chip reveals adipocyte-derived lipids trigger cancer cell migration via HIF-1α activation in cancer cells.
        Biomaterials. 2021; 269120622
        • Myasnikova D.
        • Osaki T.
        • Onishi K.
        • Kageyama T.
        • Zhang Molino B.
        • Fukuda J.
        Synergic effects of oxygen supply and antioxidants on pancreatic beta-cell spheroids.
        Sci Rep. 2019; 9: 1802
        • Kageyama T.
        • Yoshimura C.
        • Myasnikova D.
        • Kataoka K.
        • Nittami T.
        • Maruo S.
        • et al.
        Spontaneous hair follicle germ (HFG) formation in vitro, enabling the large-scale production of HFGs for regenerative medicine.
        Biomaterials. 2018; 154: 291-300
        • Li S.H.
        • Shin D.H.
        • Chun Y.S.
        • Lee M.K.
        • Kim M.S.
        • Park J.W.
        A novel mode of action of YC-1 in HIF inhibition: stimulation of FIH-dependent p300 dissociation from HIF-1{alpha}.
        Mol Cancer Ther. 2008; 7: 3729-3738
        • Muz B.
        • de la Puente P.
        • Azab F.
        • Azab A.K.
        The role of hypoxia in cancer progression, angiogenesis, metastasis, and resistance to therapy.
        Hypoxia (Auckl). 2015; 3: 83-92
        • Iyer N.V.
        • Kotch L.E.
        • Agani F.
        • Leung S.W.
        • Laughner E.
        • Wenger R.H.
        • Gassmann M.
        • Gearhart J.D.
        • Lawler A.M.
        • Yu A.Y.
        • Semenza G.L.
        Cellular and developmental control of O2 homeostasis by hypoxia-inducible factor 1 alpha.
        Genes Dev. 1998; 12: 149-162
        • Wang G.L.
        • Semenza G.L.
        General involvement of hypoxia-inducible factor 1 in transcriptional response to hypoxia.
        Proc Natl Acad Sci U S A. 1993; 90: 4304-4308
        • Semenza G.L.
        Targeting HIF-1 for cancer therapy.
        Nat Rev Cancer. 2003; 3 (721–32)
        • Semenza G.L.
        HIF-1: upstream and downstream of cancer metabolism.
        Curr Opin Genet Dev. 2010; 20: 51-56
        • Denko N.C.
        Hypoxia, HIF1 and glucose metabolism in the solid tumour.
        Nat Rev Cancer. 2008; 8 (705–13)
        • Nieman K.M.
        • Kenny H.A.
        • Penicka C.V.
        • Ladanyi A.
        • Buell-Gutbrod R.
        • Zillhardt M.R.
        • Romero I.L.
        • Carey M.S.
        • Mills G.B.
        • Hotamisligil G.S.
        • Yamada S.D.
        • Peter M.E.
        • Gwin K.
        • Lengyel E.
        Adipocytes promote ovarian cancer metastasis and provide energy for rapid tumor growth.
        Nat Med. 2011; 17: 1498-1503
        • Balaban S.
        • Shearer R.F.
        • Lee L.S.
        • van Geldermalsen M.
        • Schreuder M.
        • Shtein H.C.
        • Cairns R.
        • Thomas K.C.
        • Fazakerley D.J.
        • Grewal T.
        • Holst J.
        • Saunders D.N.
        • Hoy A.J.
        Adipocyte lipolysis links obesity to breast cancer growth: adipocyte-derived fatty acids drive breast cancer cell proliferation and migration.
        Cancer Metab. 2017; 5: 1
        • Lee G.S.
        • Pan Y.
        • Scanlon M.J.
        • Porter C.J.H.
        • Nicolazzo J.A.
        Fatty Acid-Binding Protein 5 Mediates the Uptake of Fatty Acids, but not Drugs, Into Human Brain Endothelial Cells.
        J Pharm Sci. 2018; 107 (1185–93)
        • Lan H.
        • Cheng C.C.
        • Kowalski T.J.
        • Pang L.
        • Shan L.X.
        • Chuang C.C.
        • et al.
        Small Molecule Dual FABP4/5 Inhibitors Ameliorate Dyslipidemia in Mice with Diet-Induced Obesity.
        Diabetes. 2011; 60 (A187-A187)
        • Senga S.
        • Kawaguchi K.
        • Kobayashi N.
        • Ando A.
        • Fujii H.
        A novel fatty acid-binding protein 5-estrogen-related receptor alpha signaling pathway promotes cell growth and energy metabolism in prostate cancer cells.
        Oncotarget. 2018; 9: 31753-31770
        • Mamalakis G.
        • Kafatos A.
        • Kalogeropoulos N.
        • Andrikopoulos N.
        • Daskalopulos G.
        • Kranidis A.
        Prostate cancer vs hyperplasia: relationships with prostatic and adipose tissue fatty acid composition.
        Prostag Leukotr Ess. 2002; 66: 467-477
        • Pratt V.C.
        • Watanabe S.
        • Bruera E.
        • Mackey J.
        • Clandinin M.T.
        • Baracos V.
        • Field C.J.
        Plasma and neutrophil fatty acid composition in advanced cancer patients and response to fish oil supplementation.
        Brit J Cancer. 2002; 87: 1370-1378
        • Pakiet A.
        • Kobiela J.
        • Stepnowski P.
        • Sledzinski T.
        • Mika A.
        Changes in lipids composition and metabolism in colorectal cancer: a review.
        Lipids Health Dis. 2019; 18
        • Qiu J.F.
        • Zhang K.L.
        • Zhang X.J.
        • Hu Y.J.
        • Li P.
        • Shang C.Z.
        • et al.
        Abnormalities in Plasma Phospholipid Fatty Acid Profiles of Patients with Hepatocellular Carcinoma.
        Lipids. 2015; 50: 977-985
        • Szachowicz-Petelska B.
        • Sulkowski S.
        • Figaszewski Z.A.
        Altered membrane free unsaturated fatty acid composition in human colorectal cancer tissue.
        Mol Cell Biochem. 2007; 294: 237-242
        • Zhang X.
        • Zhao X.W.
        • Liu D.B.
        • Han C.Z.
        • Du L.L.
        • Jing J.X.
        • Wang Y.
        Lipid levels in serum and cancerous tissues of colorectal cancer patients.
        World J Gastroentero. 2014; 20: 8646-8652
        • Fang Z.
        • He M.M.
        • Song M.Y.
        Serum lipid profiles and risk of colorectal cancer: a prospective cohort study in the UK Biobank.
        Brit J Cancer. 2021; 124: 663-670
        • Anada T.
        • Fukuda J.
        • Sai Y.
        • Suzuki O.
        An oxygen-permeable spheroid culture system for the prevention of central hypoxia and necrosis of spheroids.
        Biomaterials. 2012; 33: 8430-8441